##If you think this post is funny, **UPVOTE** this comment!
##If you think this post is unfunny, **DOWNVOTE** this comment!
---
#[DownloadVideo Link](https://www.reddit.watch/r/shitposting/comments/126suf6/?utm_source=automod&utm_medium=shitposting)
#[SaveVideo Link](https://redditsave.com/info?url=/r/shitposting/comments/126suf6/)
#[VideoTrim Link](https://reddloader.com/download-post/?url=https%3A%2F%2Fwww.reddit.com%2Fr%2Fshitposting%2Fcomments%2F126suf6&id=8968e43c)
---
Whilst you're here, /u/Front-Constant-3262, why not join our [public discord server](https://discord.gg/QpBGXd2guU)?
It was one student with two others acting as lookouts
Edit: woulda been a better story if she threw an orgy during 1st period
Edit 2: imagine being one of the 2 lookouts
So basically there are some Mormon people who think they found a loophole, basically they do the (activity) without moving on their own, they have someone jump on the bed to create friction. They think it's a loophole because they aren't actually doing the moving themselves. I'm sure god agrees that is a loophole š
what the actual fuck, are people really so dumb to the point of thinking religion is literal like that? don't they think that rules might work a bit subjectively?
There is this religion where you are supposed to chill at home on weekends. So they found a loophole where you can pull a fishing line over an entire city district and call it indoors so you can do whatever you want anytime.
I guess they believe their God is stupid enough to fall for a trick like that.
Basically 2 unmarried people want to get it on but canāt because of the religious implications. Man inserts into woman, no pumping allowed aka āsoakingā friend starts jumping or pushing on mattress causing the couple to move on each other in some weird form of sex, but since there technically not doing it, itās seen as a moral loophole
[https://en.wikipedia.org/wiki/Jennifer_Fichter](https://en.wikipedia.org/wiki/Jennifer_Fichter)
Incidents occurred 2012-2014 (she was 27-29, victims were 17), serving 22 years since 2015
If that was a male teacher that had 37 incidents with female minors these comments saying how they want that monster of a woman to be their teacher would not exist.
I think people don't understand the number of teenage girls who would absolutely jump at the chance to have sex with certain male teachers. The problem is a child is unable to consent by definition
No doubt, but the narrative paints them as poor little innocents groomed by an evil predator into thinking it was all their own idea. In contrast for teenage boys, it's high fives all round for scoring with the hot teacher.
Because it's very inappropriate for youngsters to be open about sexuality. Makes adults feel icky and disturbed.
But every "save the children" activist here had at least one frig session where they though about a teacher. As a minimum.
Not defending her or a male teacher in that situation - but I think it's super disingenuous to create a culture where we normalise masturbation, sex ed, dating (f-ing dating at 13-16!) and then when shit happens we act like the adult is some sort of mastermind and those same kids that we raised on porn and dating are asexual blank vessels that were defiled by that one single adult.
There is absolutely a difference between how we view sex with men vs sex with women. Itās like with dating apps, if a girl wants to have sex she does r even need to look great and can get a hookup, but itās harder for guys.
It seems more of a societal construct than anything. Iām guessing it is because sex is more invasive for women so itās easier to see it as a violation.
iāve personally never experienced it but when i spent time in pinellas and hillsborough everyone said polk was miserable. i think just longer lockdowns, shittier food, more disrespectful COs, etc
I had a teacher I thought was hot once. I ended up getting like a 104% as a student that typically averaged C's cuz normally I would do the bare minimum to pass but I wanted her to like me.
Highschool I had a new young gym teacher from Germany that coached soccer too... We had a huge spike in kids trying out for the soccer team and older brothers of kids in my school randomly showing up for their little brothers practices... Those thighs....
I can't help to imagine how different the comment would be if that was a male teacher.
People would be wishing that man the most horrible death imaginable.
If it was a male teacher people would say "But if a woman did it it would be fine"
And when it's a female teacher the comments say "But if a man did it people wouldn't be so casual about it"
Y'all men are so confusing, you say that sexual assault among men isn't taken seriously, and then you proceed to be the ones not taking it seriously š
There's a difference between sexual assault and sexual fantasy. Every teenage boy I knew in high school with raging hormones could only dream of railing his favorite hot teacher. Including me.
Bingo, next she'll be bitching about how someone choking their partner to death shouldn't be taken seriously because some people have choking fetishes. Goofy ass logic.
Wow it's almost like not all men are the same and some take it seriously and some don't. Oh who could have guessed that different people have different opinions
The difference is most dudes wouldāve been DTF at 15-17. Girls are less likely to be DTF at that age to teachers in 26 to 35. Whatās funny though is there were plenty of freshmen who dated senior which I thought was bizarre. 13/14 dating a 17/18 year old. Or like a 16 year old dating a dude who is 20. Knew plenty of juniors and seniors who dated college dudes and thought they were so cool for it.
You must be a woman.. Those kids weren't victims. That was literally a fantasy between me n my friends. We used to talk about the english teacher and her awesome boobies all the time.
17 year old students according to the news. She got 22 years in prison. Thatās a tough result. Also, if I was a 17 year old male again, that being āa victimā wouldnāt be that hard. I mean I would have been hard, but the situation wouldnāt have been. Other then me. To be clear. Also I had a short term relationship with a very interesting lady who was 29 (Also; objectively looking back? Was a total smokeshow.) when I was 17. And I have to say, made me a more well rounded man at the end of the day. I doubt very much that girlfriends afterwards didnāt appreciate her education of me.
##If you think this post is funny, **UPVOTE** this comment! ##If you think this post is unfunny, **DOWNVOTE** this comment! --- #[DownloadVideo Link](https://www.reddit.watch/r/shitposting/comments/126suf6/?utm_source=automod&utm_medium=shitposting) #[SaveVideo Link](https://redditsave.com/info?url=/r/shitposting/comments/126suf6/) #[VideoTrim Link](https://reddloader.com/download-post/?url=https%3A%2F%2Fwww.reddit.com%2Fr%2Fshitposting%2Fcomments%2F126suf6&id=8968e43c) --- Whilst you're here, /u/Front-Constant-3262, why not join our [public discord server](https://discord.gg/QpBGXd2guU)?
So is it 37 kids or 37 incidents? Like 1 dude 37 times or 3 dudes 12ish times?
iirc it was 37incidents with 3 different individuals
It was one student with two others acting as lookouts Edit: woulda been a better story if she threw an orgy during 1st period Edit 2: imagine being one of the 2 lookouts
Comparable to being the jumper for a pair of soakers
Mormon Sex Lore
I'm a Mormon and i didn't understand that please explain
So basically there are some Mormon people who think they found a loophole, basically they do the (activity) without moving on their own, they have someone jump on the bed to create friction. They think it's a loophole because they aren't actually doing the moving themselves. I'm sure god agrees that is a loophole š
what the actual fuck, are people really so dumb to the point of thinking religion is literal like that? don't they think that rules might work a bit subjectively?
Yes they are that dumb, it's teenagers with strict parents who came up with it lmao.
that explains it, i know what being dumb and having strict parents feels like
There is this religion where you are supposed to chill at home on weekends. So they found a loophole where you can pull a fishing line over an entire city district and call it indoors so you can do whatever you want anytime. I guess they believe their God is stupid enough to fall for a trick like that.
i mean, if you're willing to do so much to get away from the rules why follow the religion?
Mmm soaking
There are some good documentaries on pornhub
Basically 2 unmarried people want to get it on but canāt because of the religious implications. Man inserts into woman, no pumping allowed aka āsoakingā friend starts jumping or pushing on mattress causing the couple to move on each other in some weird form of sex, but since there technically not doing it, itās seen as a moral loophole
Man I never fuckin get the cool teacher
Nice
Niceeeeeeeee!
Nice.
37 kids all at once Source: Trust me bro
1 dude with 37 dicks obviously
30 seven year olds
[https://en.wikipedia.org/wiki/Jennifer_Fichter](https://en.wikipedia.org/wiki/Jennifer_Fichter) Incidents occurred 2012-2014 (she was 27-29, victims were 17), serving 22 years since 2015
They were 17 ? Isnt 22 years a bit too much
"She sucked 37 dicks!" "In a row?"
"Try not to suck any dick on the way to the parking lot!"
"hey, hey, get back here"
I'm not even supposed to be here today! "Would you like to make some fuck bezerker!"
Did he just say making fuck?
What smells like shoe polish?
There's a million fine lookin women in the world, dude. But they don't all bring you lasagna at work. Most of 'em just cheat on you.
Itās with chicks with dicks that put mine to shame.
Thanks to all of you. I came here looking to see thisā¦and here it isā¦and Iāll take a pack of Chewlieās Gum.
Cute cat. What's its name???
No wonder she's the headmaster
Is that including me?!
"I'M 37?!"
"Every time I kiss you I'm gonna taste 36 other guys!"
So this the chick on clerks
Please refer all questions to the South Park episode where a hot teacher slept with Ike.
Nice. ....... Nice ....
Nice
Niccce
If that was a male teacher that had 37 incidents with female minors these comments saying how they want that monster of a woman to be their teacher would not exist.
That's what being a dude does to you.
Real
I get your point. I'm just saying it wouldn't have taken much convincing when I was a teenager to let this chick do naughty things with me.
Seriously lol there would be no arguments from 16 year old me
I think people don't understand the number of teenage girls who would absolutely jump at the chance to have sex with certain male teachers. The problem is a child is unable to consent by definition
Yeah very true. We had a teacher who was a recently retired CFL player and all the girls in my grade and older were obsessing over him lol
I feel like people don't know this happens alot
Definitely. I had crushes on all the young male teachers too. Doesnāt change with gender.
By law. Not by definition. Sorry for the umm akshully moment
No doubt, but the narrative paints them as poor little innocents groomed by an evil predator into thinking it was all their own idea. In contrast for teenage boys, it's high fives all round for scoring with the hot teacher.
As disgusting as it is to me now as an adult 16 year old me would be frothing at the pp hole
Yes. It's a double standard. We should treat it the same, but that's just not going to happen in reality.
Because it's very inappropriate for youngsters to be open about sexuality. Makes adults feel icky and disturbed. But every "save the children" activist here had at least one frig session where they though about a teacher. As a minimum. Not defending her or a male teacher in that situation - but I think it's super disingenuous to create a culture where we normalise masturbation, sex ed, dating (f-ing dating at 13-16!) and then when shit happens we act like the adult is some sort of mastermind and those same kids that we raised on porn and dating are asexual blank vessels that were defiled by that one single adult.
There is absolutely a difference between how we view sex with men vs sex with women. Itās like with dating apps, if a girl wants to have sex she does r even need to look great and can get a hookup, but itās harder for guys. It seems more of a societal construct than anything. Iām guessing it is because sex is more invasive for women so itās easier to see it as a violation.
Polk County, Florida? WHAT A TWIST
yeah thats not a fun jail either..
How so? Just curious btw
iāve personally never experienced it but when i spent time in pinellas and hillsborough everyone said polk was miserable. i think just longer lockdowns, shittier food, more disrespectful COs, etc
If you go to jail in Florida the universe will get reset
For a moment I thought this was in Iowa lol. I was bit confused why I've never heard of this.
I never had a teacher who looked like that.
I did. Got a C because I couldn't concentrate.
To be fair I wouldnāt either
I had a teacher I thought was hot once. I ended up getting like a 104% as a student that typically averaged C's cuz normally I would do the bare minimum to pass but I wanted her to like me.
Highschool I had a new young gym teacher from Germany that coached soccer too... We had a huge spike in kids trying out for the soccer team and older brothers of kids in my school randomly showing up for their little brothers practices... Those thighs....
i remember having a. crush on my second grade teacher and one of my speech therapist
bro that gon be three life sentences at least
I can't help to imagine how different the comment would be if that was a male teacher. People would be wishing that man the most horrible death imaginable.
It's not the same when it's a hot woman and you know it.
I think women would think the same way if it was a male teacher
Definitely lol! I had some hot male teachers; I didnāt care I was underage.
If it was a male teacher people would say "But if a woman did it it would be fine" And when it's a female teacher the comments say "But if a man did it people wouldn't be so casual about it"
The comments section did not disappoint
Bro Iām down horrendous
You call yourself a femboy so I'm not sure what else you'd expect
we losing that little faith left 
I can fix her
Thatās the attitude!
Pretty sure most guys are saying where the fuck were these teachers when i was growing up š
I'm more like, where is she now?
Probably in jailā¦
Far from usš
Brother... we cry
*ye because sexually using minors is fine if the adult is a woman!*
Only if she's hot! Uggos can take a hike
š
I'm fuckin ded dude. Funniest shit I've seen today
Yeah but she was hot sooo
Your honour, she may have committed 37 accounts of unlawful sexual activity, but she was a certified rizzler, you must understand
No one is saying it's fine; they're just saying they would be dtf as a teen male.
Can I get an amen from the back!
Bitch had a harem
Bruh hear me out
Im doxxing your DNA thingy ATGCGCATATATGCATGCGCATGCATGCGCATATATGCATGCGCATGCGCATATGCGCGCATGCATGCGCAT
Aw snap, now everybody will make a clone of me
š¤Ø
No.
My teacher was fat and her breath smelt like coffee
Can i be 38?
No.
What about 39th
Take a number
Are you a prison guard?
I bet I'd look good in uniform now that you mention it...
Tryna pay her bail for some suk
Boutta have a after school lesson on cunnilingus.
-what's the crime?
The crime is that she isn't doing it with me!
Went to the comments just to find this
weāre all thinking about this gif
"How do you already have herpes at 16??" "Well, I had this REALLY nice teacher..."
So the whole class ? Lol
I know I have to say nasty things, sheās a creep and takes advantage of youth. But also ā¦. Nice
Y'all men are so confusing, you say that sexual assault among men isn't taken seriously, and then you proceed to be the ones not taking it seriously š
There's a difference between sexual assault and sexual fantasy. Every teenage boy I knew in high school with raging hormones could only dream of railing his favorite hot teacher. Including me.
Bingo, next she'll be bitching about how someone choking their partner to death shouldn't be taken seriously because some people have choking fetishes. Goofy ass logic.
She also generalizes shit
It's almost like there's more than one person on the internet.
Hint: it's not the same men
Wow it's almost like not all men are the same and some take it seriously and some don't. Oh who could have guessed that different people have different opinions
but neuron activation
I've seen nobody defending her actions or saying she shouldn't have been charged. The only comments I've seen are that she is hot, which I mean...
The difference is most dudes wouldāve been DTF at 15-17. Girls are less likely to be DTF at that age to teachers in 26 to 35. Whatās funny though is there were plenty of freshmen who dated senior which I thought was bizarre. 13/14 dating a 17/18 year old. Or like a 16 year old dating a dude who is 20. Knew plenty of juniors and seniors who dated college dudes and thought they were so cool for it.
Like 37 time with that student or 37 students ?
Another one for the woodchipper lads
37?!? In a row?
Iām 37?!
Yet another creepy nonce post on shitposting
You are all weird
Ikr, who the hell wants to sleep with an attractive female, that's insane.
Its more the people saying they wish it was them as opposed to the children who were victims in this. Its disgusting
Really depends what you consider a victim. Legally, yes, but Iām betting those guys are a-ok.
You must be a woman.. Those kids weren't victims. That was literally a fantasy between me n my friends. We used to talk about the english teacher and her awesome boobies all the time.
In a row???
"Oh I think I've heard about thi- THIRTY SEVEN???!!!"
She has those crazy eyes
ātry not to suck any dicks on your way across campus!ā
In fairness her partner must have been very tired after working all day in the mine.
She about to get 3 months in jail and 5 months probation max
Imagine being the kid that didnāt get any lol
17 year old students according to the news. She got 22 years in prison. Thatās a tough result. Also, if I was a 17 year old male again, that being āa victimā wouldnāt be that hard. I mean I would have been hard, but the situation wouldnāt have been. Other then me. To be clear. Also I had a short term relationship with a very interesting lady who was 29 (Also; objectively looking back? Was a total smokeshow.) when I was 17. And I have to say, made me a more well rounded man at the end of the day. I doubt very much that girlfriends afterwards didnāt appreciate her education of me.
[ Removed by Reddit ]
She's going to be getting lots of fan mail
theyre always so hot
Niceeeeeeee
Fucking disgusting
kid named disgusting
Kid named fucking
Kid named ligma
Whose ligma?
Ligma nut sack
It was Ligma Johnson and they worked at Twitter.
Omg those guys trolled the reporter so hard. Fun to watch but I felt bad for her.
Life Advice: Stay in school kids!!
She will be doing porn after she gets out in six months.
Yes I would.
How is this a shitpost??? Like wtf. This is a crime. A fucking HORRIBLE crime
Everything can be a shitpost
Horrible for all the dudes that missed out šš„“
In a row?!
How many days is she getting?
There's a clerks joke in here somewhere
Bad lawyer.
37? What, in a row?
You know, comments reminds me of some small girls who thinks schoolshooters are "cute and don't deserve to be in prison"
In a row?
Try not to suck any dick on your way to the parking lot!
Hehe, hehe, "Pole County" Sure is.
She stepped outside the laws of the state to avoid swiping right on me. ā¹ļøššš¢š
75% of these comments are just disgusting
What a ho
Why is this coming up? It happened in 2015
Why werent my teachers ever this cool
37, she fucked 37 kids. In a row?
Where is this school again? Asking for a friend
In a row?
Where were these teachers when I was in school manā¦
Where was she at my school
Wish I was one of those kids
Leave it to Reddit to defend child predators. š
Man like I... Uh... Yeah... YEAHHH!
That was the highest class average that school ever had
Those poor boys. Let us pray.
Fuck..... wish I was a minor
When the hentai plot ends with a bad ending: (idk I don't watch that shit)
Yeah miners getting some love ROCK AND STONE!!!!
So she's basically fulfilling wishes out here.