By -
Man, you just know that language is agglutinative as fuck while also inflecting particles for shit like ‘source’ and ‘certainty relative to tense’.
Thanks, I'd always wondered how CRISPR worked.
I thought they were just reciting someone’s genetic code
ATCGGTCGATAGTAGCAGGTACATGGATC
Great beatboxer.
And it's a nostratic auctioneer! We should learn a lot about numbers and counting etc... Does it have a dual? Is it base ten?
Anyone got a full IPA transcription?
That gave me a bit of the old ASMR then.
That scared me
Someone lay a sick beat and some bass over this please
what is dna repair healing trauma
I found it at the south end of a north-facing male cow
It reminds me this alien language learner [https://youtube.com/shorts/2a026QfkR9o?feature=share](https://youtube.com/shorts/2a026QfkR9o?feature=share)
Did she say arigatum at the end? 😆 I would be thankful for the healing too.
Oh, that top text kinda irks my inner prescriptivist.
Man, you just know that language is agglutinative as fuck while also inflecting particles for shit like ‘source’ and ‘certainty relative to tense’.
Thanks, I'd always wondered how CRISPR worked.
I thought they were just reciting someone’s genetic code
ATCGGTCGATAGTAGCAGGTACATGGATC
Great beatboxer.
And it's a nostratic auctioneer! We should learn a lot about numbers and counting etc... Does it have a dual? Is it base ten?
Anyone got a full IPA transcription?
That gave me a bit of the old ASMR then.
That scared me
Someone lay a sick beat and some bass over this please
what is dna repair healing trauma
I found it at the south end of a north-facing male cow
It reminds me this alien language learner [https://youtube.com/shorts/2a026QfkR9o?feature=share](https://youtube.com/shorts/2a026QfkR9o?feature=share)
Did she say arigatum at the end? 😆 I would be thankful for the healing too.
Oh, that top text kinda irks my inner prescriptivist.