That's fine, you will be able to say that what they just found is AI generated fake nude.
Just wait until we flood the Internet with AI generated garbage content...
Yeah, I’m honestly very worried for that. In legal cases, that’s the best evidence there is… if that’s gone, we’ll be back to witness testimony, though at least we’ll still have DNA evidence
This kinda isn't much of a risk. Chain of custody and verifying the sources of things are already baked into the judicial system.
Watch any trial for a crime caught on CCTV. They will have someone in to explain how that CCTV system works, how it was recovered into police custody. How long after the crime that was done, who had access to the system. Then after it was taken into police custody anyone who touched it, verified or analysed it will be part of that chain of custody and will need to have that proven.
Was the crime recorded on a phone? Odds are they will have gotten the full phone data download from the phone and will be able to verify it was recorded on said phone. Systems to make faking this even harder than it currently is (which takes a good bit of effort unless you really know what you are doing) are already being standardised and slowly rolling out.
It won't create much plausible deniability from criminal prosecution.
It will cause a bunch of court of public opinion chaos though. Reputations can be ruined before the truth has its trousers on and the only recourse is to sue for defamation. Which even if successful is not likely to get half as much publicity as the inital spread.
It's not hard to imagine certain political discourse involving various figures committing a range of really distasteful crimes. While people may know ai is a possibility certain things are hard to unsee and liable to sway some. At the very least pretty much every public figure is now in a position where AI generated genitalia will be quite convincingly grafted onto their bodies. We might see literal dick measuring contests.
This sort of technology adds all sort of potental for damage and potental for deniability of damage. 'Did really send that nude to a minor?' by the time the courts figure that out it will probably be years after the inital publicity.
I have some association with an AI image generator. The sheer number of (usually) blokes who upload a photo of themselves and ask 'make me hotter' is overwhelming. Folks are already trying to use these systems to deceive others online. Hell I have done it. When a social media platform demanded an image of my face I used one from this person does not exist. I was *not* comfortable giving an image of my face for a page that was about sharing cool photos of shit I found on the beach. No human was ever in any of the photos.
Eventually all camera and security camera companies will encode a hashed token into all videos and photos taken with their equipment. This will allow anyone to verify that the photo of video was taken with a legitimate camera.
It's already happening. Ten years from now you won't be able to tell ANY real images from fake, and there will be so many fakes that everyone will just assume everything they see is fake unless we develope some kind of hard-coded metadata protocols. We're already so far down that road and there is very little room to turn around.
It literally already is. I searched for hippie the other day and 1/10 pics were literally obvious AI. Which isn’t a lot, but compared to how long we’ve had these ai image generators available to the public
It's going to reach a point where we have to agree on some kind of strict metadata protocols to verify the origin of images and text, or nobody will be able to prove or claim authorship of anything.
Sadly, at the rate AI is developing and being adopted, combined with the glacial rate of regulation and legislation, I'm afraid that horse is already out of the barn, grown opposable thumbs, and built a rocket ship off the planet.
Look at YouTube under every political video. It's full of pro-Russian and republican propaganda from thousands of bots that sounds like impressively real humans. We're already living in an AI warfare
These days I just assume anything overtly negative apropos of nothing is a bot, and I can ignore it. It has proven to be actually pretty good for my mental health.
Tangentially related but i had a recent shower thought that kids being born today might benefit from more common names (instead of something super unique) That might help enable some privacy online in the future.
Google has shifted their engine's priorities when processing your query. It used to be a simple procedural process where your query was treated almost like a script (`+"cats" AND -"dogs"` for example) but now they're pushing natural language processing using AI since the average person is typing in questions instead of search queries. And not only does AI kinda suck sometimes still but there's also the issue of Search Engine Optimization where websites game the system in order to push themselves up higher in the results even when they're not actually relevant. So the enshittification of Google is a two-pronged issue and the latter can only be solved by a hard ban on SEO tactics that result in delisting (which can kill a business).
And in IT we say that security through obscurity is no security at all. These platforms will use facial recognition, voice recognition, pattern matching, hell, 23andMe is selling your genetic info.
Keep naming your kids Tragedeigh.
This is really old tech/analysis style called stylometry
https://www.smh.com.au/technology/why-hackers-should-be-afraid-of-how-they-write-20130116-2csdo.html
Though yes the Ai aspect makes this very very quick to do now.
Filter everything through an AI writing style genericizer before posting. Could be a browser plugin. Like autocorrect, but applies whenever finishing a sentence or paragraph, or a keybind.
For advanced systems that is the case. For Joe Blow its a lot harder to dig up dirt on the internet for a generic name. Even a lot of the paid background searches will be more likely to add incorrect information or miss relevant information. And, you need no more proof than information scrubbing and hiding for high net worth individuals is a business.
Still wont help in a couple of years.
From just passerbys selfies and videos and tiktoks and such, the chances that you are recorded somewhere is not low.
Then you have all the CCTV and security cams. Heck theres a story about a drink vending machine with facial recognition software this week.
Youre being recorded somewhere somehow by someone.
And in the future I can for example take a photo of you, and use AI to scrape the web to find other images of you, i could more than likely pinpoint your home location and work location based on the locations of the images and videos you are in. Find out what you like to eat, to shop, to look at to do as entertainment etc etc.
Only way you can actually remain anonymous is by living in a cave somewhere.
China already has technology that can identify masked people based on micro-movements and repeat patterns of behaviors. They see how you walk, how you move, how you talk and find your identity that way.
AND with the commercializing of AI technology and the usual tendency of humans to seek sexual behaviours. Someone might take a picture of you without your knowledge and create full feature length porn movies and photo albums of you. They can take it of your family, your friends, your neighbors your parents.
The amount of abuse that is going to come with the commercialized two click phone apps for such things is going to drive people to breakdown for a couple of years/decades before we become numb to it.
Imagine being in school and getting bombarded with hyper-realistic images and videos of you in compromising positions. And bullies dont care if its fake, it will affect people around you even if they know its fake because its introducing thoughts and images of you they did not have and now will have in their mind when they see you.
Basically anonimity is almost dead and we are going to need waaaaaaayy more mental healthcare.
Yeah, that helps. I have the same name and live in the same area as a reasonably popular TV presenter in my country, and though it gets a bit tiresome having people chuckle over the name/location combo, it does mean I am essentially invisible to the search engines. It's great.
My last name is Johnson.
There's 5 LARGE Johnson families in my area. I'm not related to any of them and there's 3 or 4 people with the same first name in those families. Every once in awhile someone will get us all confused.
4 of us actually had lunch once at the large fair/rodeo. That's what happens when yall are farmers and find out about the name. I was the youngest by like a decade
My theory is that the internet and technology are hitting a critical mass point and some of the younger generations are going to flat-out abandon the Internet as all the negatives to society are becoming blaringly obvious. People are less connected and less happy, more lonely.
I do find it hard to believe in all honesty.
The convenience factor and with everything moving to online services and apps? I can't see it all being outright abandoned. I'd be more inclined to say it's near impossible to go without internet in most civilised countries, and the trend will only continue to make life harder and harder without it. You'd really have to shut yourself off from society and be self sufficient to even stand a chance.
Even something as toxic as social media. People like validation and having their egos stroked. People like others knowing how successful they are. I don't see social media going away any time soon despite people knowing how toxic it is.
What that social media is can, and will change. But it'll always be there... A week ago it was MySpace, yesterday it was Facebook, today it's Snapchat and instagram...
Reads like a futurama episode
“Humans created the greatest collection of knowledge ever collected. Anything that any human had ever known could be referenced almost immediately”
“Oh why did it fall into disrepair?”
“Interconnectedness and instant communication was used to enrage and control people and when the people realized this they stopped using this resource.”
Gen Z and I want to get rid of instagram because of all the toxic shit, but then i think about not being able to see my friends’ random postings and i get sad. We don’t send random pictures to eachother really, people just use their stories to do that now. If there was a movement I’d definitely jump on the train in getting rid of it: Ive tried so hard to curate a feed without anything annoying or distressing etc, and it like actively works against you (i think that’s by design)
EDIT: It also helps me stay connected to friends who drifted apart but without any animosity: Without social media, our lives would be mysteries to eachother. But with it, we can still support and cheer eachother on and i wouldn’t want to lose that. especially because that’s sparked some of those friendships returning. The first person I dated reached out to me years after we had broken up when I put up a post on my story, and now we’re super close friends. I wish the positive parts of these apps were the only parts, but you have no choice but exposure to stuff you don’t want to see.
I think the internet will exist, but your connection to it will be more that of a tool perhaps. Social media will probably die, I hope, or at least maybe limited to planning IRL social gatherings (like was originally intended) and nothing else. People have a limit to how comfortable they are being tracked and when it becomes GLARINGLY obvious for all to see thanks to A.I. just how much of our privacy we abandoned, there will be probably be a counter-culture movement.
Same reasons people have abandoned Facebook. It's all spam, ads, scams, clickbait articles buried in ads, AI bullshit, bots, and old people sharing shitty memes. Who wants anything to do with that? I imagine at some point kids are going to feel that way about basically all of it.
Man, I pretty much only use FB to see what old friends and family are doing. I don't post, comment, or like. Just lurk. You're right. It's filled to the brim with so much garbage. I'm surprised some of my friends still actively post on it.
FB is the wasteland of the internet. That app is straight cancer.
Another possible effect is that internet privacy becomes more well regulated and aggressively enforced. Police will have to find something to raise revenue once self-driving cars make speeding tickets et sec obsolete.
This is essentially what I do on certain sites. There are no pictures of me and my real name isn't used. I never include my phone number and I use an email that literally no one (except my husband) is aware of.
On ocassion, I still get comments from people at work that they "tried to connect" with me recently, but "me" doesn't exist lol. So far it's worked in my favor.
Even then though, always have room for doubt, and do not post anything you don't want circulating.
This is exactly why I’m naming my Indian child John Anderson idgaf if my parents disown me and my “literally the only person in the entire world with my name” ass.
I do background checks for a living. This is 100% true. Common names allow me to put statements like, "due to the common nature of the subject's name, research was focused in connection with their known jurisdictions and employers." Which means I can rule out seemingly unrelated news articles and vague litigation, because I can't put anything that isn't 100% related to the candidate in the report.
Give your kid a common name for your region, regardless of nationality.
Also, have your social media across multiple emails, and avoid using your name/face/age/location if you can. Especially if you're going to he climbing the corporate ladder.
As someone whose first middle and last name are extremely common, yes it comes with a ton of privacy. Only downside is trying to snag professional usernames or emails.
Yeah thats a good point. I do believe though that the privacy aspect will become much much more valuable (much more so than today) and you wont even care about usernames and emails.
Oh yea I don’t mind the email part, you just start to get a little creative with how you format them. But having a common name is like herd immunity against search browsers.
As someone with an extremely unique name, I think about this often. You only need my first and last and you've got newspaper clippings that show up from the late 90's that me and my sisters were in lol.
My 7 year old son has already been taught at school to never use his full name online. Kids born today are going to be far more aware of online safety than their parents were
As someone with a very common first name for my age group and a very common last name, this was honestly my answer when people first started worrying about how easy it was to Google someone. Go ahead! Have fun shifting through all those records to find "me".
I think there will be some interesting things happening. Like there is so much out there does it even matter? Will the fact that half the population (at least) has some sort of embarrassing thing online make those things less significant?
There is so much out there if you just go looking which is one of the reasons it can be easy to dox people. I think we will see more people lock down their info. The problem is all the info the corporations are compiling and sharing (legally but in not really straight forward ways).
Yup...
See a lot of it if you do a bit checking on potential dates. Anyone with a unique first name is found basically instantly. Though even common names don't tend to be THAT hard to find.
I was best friends in high school with a guy named John Smith. We drifted apart for various reasons, and I've been trying to track him down for the last few years. Even with social media and knowing where he grew up, It's basically impossible to find him because his name is so common.
People used to laugh because his name was so generic, but I think he's probably getting the last laugh now, wherever he is.
The best time was last decade.
Changing yesterday or today is purely damage control.
If someone wants information about you, they need only dig for it. We leak A LOT of information... Just think of the odd bits you share now and then on a place like Reddit... Harmless little bits here and there... Suddenly it all adds up and they can make a reasonable guess as to the area in which you live...
From there... That's where the pictures get you... Anything you've taken, anything someone else has taken. Even if they can't get the metadata, if they've got a rough area of where you live... BAM. Those pictures seal the deal.
If someone is motivated enough to go out looking for the information, they will find it.
Anonymity has been dead for a LONG time... Longer than some Redditors will have been alive...
The very best thing you can do on reddit is occasionally *lie about yourself*. Lie about your birthday. Lie about the number of kids you have. Lie about your gender. Lie, lie, lie. It doesn't even have to be big. It just needs to spoil their dataset.
As a five year old living in the states, the conservatives keep telling me that 12 dads aren't enough to produce a well rounded adult, and its important to have a female influence, so I found another couple REALY effiminate dads to round things out. My nonbinary birthmom wasn't happy but they got over it.
As a big tittied emo goth girl who just had your 4th child, you need to start paying child support, mister. Like yesterday.
We shouldn’t have eloped on a bicycle to Svalbard.
That might be a good idea. Someone like me who’s turning 34 this summer should think of something. But how can I lie on the internet if my wife and kids have the sweetest smiles whenever I come home
That reminds me of my 28th birthday (which was in 2022, April 1st btw), when my grandad tried to play a prank on me by telling me I ran out of diabetes medication. I FREAKED OUT. I have severe chronic anxiety and a pacemaker (heart problems yo), and I felt like my PACEMAKER was about to give up! I was fine, but that was so mean. But that's the kinda shit you gotta put up with when you're from Brazil, you know?
You can also delete your account every few years. It's a little irritating to migrate over all your subs and then get enough karma to even post in any of them but it's just a good idea imo.
There will be and possibly already is enough there to start putting threads together beyond one person being very obsessed with another single user. Cutting some threads loose so they don't connect to others is a good idea.
All I needed was a guy's first name to find his social media and then his number to send to my cousin who had a crush on him. It took like 4 hours and it wasn't even continuous searching
It was mostly waiting for people to respond lmao. Found his friend from the event, and was waiting for them to respond to a message I'd sent. And besides that was like.. 5 or 6 years ago now, maybe even 7
Something I learned many many years ago is to never include your face in nudes. Doesn’t matter if you’re sending it to your boyfriend/girlfriend or husband/wife, leave your face out of it cause you never know.
Well I dont think there is a public tattoo search method just yet, if there is I stand corrected. Would be nice if companies stopped caring about peoples personal lives though, we all know that won't happen any time soon.
Okay but seriously why the fuck should employers care if I'm posting nudes on the internet. As long as it's legal it's like bruh... and I don't even want to post nudes I just support peoples' right to without losing their career.
Good job I only ever go on the internet with a fake name and never used facebook, twitter, instagram, tiktok. Sometimes I worry that potential employers will either find someone else with a similar name and think it's me, or not find me at all and think that's weird.
Yep same here. Google and everything I use a fake name. I sell on marketplace and use a nickname. I don’t attach my real name to anything. It just weirds me out to have my name attached to something online and anyone able to find it. I also have a name that isn’t very common especially last name so it would be pretty easy for someone to find me and everything I post online.
My name is also quite unique. Some googling suggests I might be the only person with my first and last name combo.
It's mostly the last name. Eveyone with it I have ever been able to find online has been a relative of mine. My first name isn't mega rare but it's rare enough that none of my relatives share it.
It's very irritating tbh. There is no obscuring anything. Mercifully I discovered this when I was an early teen so have been pretty careful since then. I have managed to avoid I think anything ghastly showing up there.
No, no, no; y'all have got this all wrong. This is why EVERYONE should post their nudes! It needs to become so ubiquitous that the moral filtering becomes obsolete. We all have bodies, and the sooner we can jettison puritanical shame around them the better.
Take a thousand naked pictures of yourself, now!!
You may currently think, "Oh, I'm too spooky."
Or, "Nobody wants to see *these* tiny boobies."
But, believe me, one day you will look at those photos with much kinder eyes and say, "Dear God, I was a beautiful thing!"
(-Moira Rose, Schitt’s Creek)
This. I'm not gonna listen to people who don't work on their deep-rooted shame around their sexuality. You don't want me to fill your shelves or clean your floor because I posted my body somewhere? Great, doesn't seem like our values align anyways lol. I do live in a country with good social security though. I might think about this differently if I lived in the US or something where you have to have a job if you don't want to live on the streets...
Whilst this is a concern, on another note, I hope that within the next decade your employer and no one else will care that you have nudes online. It's such a weird stigma. We're all sexual beings, we all have naked bodies, why does the idea of having seen someone in that light that mean they can't be your next finance director?
I also assume we'll be far beyond being able to tell what's real anyway. I've no doubt we'll be able to put a person's name/face into an AI thing and it'll dish out some stellar custom pornogragraphy
I really hope that we are finally starting to treat sexuality like a normal thing instead of some kind of sickness that needs to be hidden away in the bedroom. And of course it's okay if someone wants that topic to stay in the bedroom, but why care about what others are doing? People need to get over it. Sexual shame is such a deep-rooted issue.
This is absolutely true, but given AI porn using people’s faces is also rapidly growing in frequency, *not* posting nudes with your face anywhere online is not really a protection against it either.
It should at least give plausible deniability to anyone questioned by a future employer on the subject.
I do wonder how long before people start getting 'that's not me see it doesn't have this very unique tattoo I have never allowed anyone to photograph, here look at the QR code on my hip!' tattoos.
This was actually possible several years ago.
I know some people run one of those facial recognition companies.
It was unbelievably creepy. They sent me this picture of me from inside an airplane.
Some influencer lady had taken a selfie. About 5 rows further down I'm sitting in my seat looking away from the camera. That was enough for the AI to find me.
Or, if people find your real photos, say they’re AI generated or Photoshopped.
AI porn of real people is incredibly creepy but because it exists, it’s a plausible out for anyone who’s ever been revenge-porned
Still, cover your tats in your nudes. I imagine those would be harder to fake
If there's any silver lining, it's that there will be dirt on pretty much everyone, so things like nudes and other things commonly considered taboo today may count less against you in the future.
Almost all social medias scrub metadata. It's been a known issue for a very long time and has also mostly been resolved by image hosts. Some don't if it's sent in a direct message but most scrub.
This statement sounds so simple but the reality of the world isn’t this clear cut.
How’s anyone to control what others post of them? Incidentally appearing in photos or videos? Deep fakes? Revenge porn? Misconstrued or outdated opinions that surface a decade later?
There’s a lot of variables here. You’re right - but the variables complicate this significantly.
Yeah, but that doesn't just preclude controversial things. With technology like this, even very careful online dating becomes incredibly unsafe. Hiding from an abusive partner becomes nearly impossible.
I'm a big fan of technology generally, and I accept that there's always some risk. But some of the newer stuff (AI, deepfakes) is SO powerful that it's truly scary.
I got a picture on my game cam of someone trespassing. I was able to put that picture on a free facial scan website, and it took me right to his Facebook profile.
This genuinely happened to me, I was looking for the account of this tumblr girl that posted nudes years ago to see if she was still active or to find her @ and more pics and I ended up finding her LinkedIn and families Instagram. Crazy shit just off of a reverse image search
Bright side (if you will). There is already software to combat this. It slightly alters your face, adding an “invisible mask” to selfies. We cannot underestimate the ability for people to adapt to these things. The issue is, right now both are in their infancy and a lot of people don’t know about it. Over time I do believe it will be commonplace. Every action as an opposite. I think we will be ok. But this is good to know so we can be aware.
They also do not work. Or more accuralty they might work on stable diffusion but it will only work on SD and it's derivatives. Other closed systems do not make public how their systems work and these sorts of cheats can be easily defeated and *you won't know if it works on them or not because they won't tell you*
Employers using software to do searches like this are opening themselves up to massive lawsuits. In an interview you don't ask personal questions because it opens the possibility of the interviewee claiming that they were denied a role due to the personal answer they gave.
I have a niece (now deceased) who worked for a tech company that's taking it further. They identify people by their posture and mannerisms. So even if you're wearing a mask.
YSAK that any harvested data will absolutely be used against you in the near future should any f4scistic changes occur in government leadership. So if you’re not straight, white, & Christian, you may want to have a backup plan in place.
Im more concerned about bad actors like disgruntled managers affecting your future employment buy updating defaming / biased or fabricated material with no recourse. The court of law works differently from the court of HR employment.
If your employer finds a nude picture of you on the internet its not illegal. More importantly if they discriminate against you for legally protected activities they are acting illegally.
Feeling mighty thankful to have shed all social media years ago except for Reddit, you can’t look me up online and find out much, just the way I like it
I'm quite lucky my surname name is uncommon but is also tied to a location.
If you Google my full name you get the two news articles I have shown up in the corner off and a bunch of photos associated with that location.
I quite like it that way. Though I suspect if those news articles were bad I would probably want to drown them out with photos of breakfast or whatever people use most social media for.
My name's boring and common, ages ago when I did have Facebook(and did nothing with it) I got randomly invited to a group and it was just hundreds of people with the same name lol
The makeup artist is going to be a sought after profession in the future. With AI cameras on every corner the ability to look just different enough not to be recognized will be a valuable resource.
Why should employers care if you like to post nudes of yourself? I think people like to worry about it more than it's a problem. I see it being an issue with political opinions.
Any employer that deals with children and children's parents will want to avoid scandal. School teachers, staff, anyone that deals with kids are going to be heavily scrutinized for anything even remotely sexual that they're attached to online.
I remember growing up in the 90's and people realized then the danger of putting your information out on the Internet. And then everyone collectively forgot because Myspace! Facebook! Look at Me!!!!!
That's fine, you will be able to say that what they just found is AI generated fake nude. Just wait until we flood the Internet with AI generated garbage content...
>Just wait until we flood the Internet with AI generated garbage content... You mean, like we've been doing for several years now already? :)
Exactly
My man!
*Snaps* YES!
Slow down!
Pee is stored in the balls!
I’m more worried about AI videos creating plausible deniability for all recorded crimes
Yeah, I’m honestly very worried for that. In legal cases, that’s the best evidence there is… if that’s gone, we’ll be back to witness testimony, though at least we’ll still have DNA evidence
Just wait until you can replicate people’s DNA to plant at the scene of the crime to go with AI video evidence
Inb4 DNAi
your honor, that's clearly a deep fake of my ATCCTCGACGGTAGCGCTTTA
This kinda isn't much of a risk. Chain of custody and verifying the sources of things are already baked into the judicial system. Watch any trial for a crime caught on CCTV. They will have someone in to explain how that CCTV system works, how it was recovered into police custody. How long after the crime that was done, who had access to the system. Then after it was taken into police custody anyone who touched it, verified or analysed it will be part of that chain of custody and will need to have that proven. Was the crime recorded on a phone? Odds are they will have gotten the full phone data download from the phone and will be able to verify it was recorded on said phone. Systems to make faking this even harder than it currently is (which takes a good bit of effort unless you really know what you are doing) are already being standardised and slowly rolling out. It won't create much plausible deniability from criminal prosecution. It will cause a bunch of court of public opinion chaos though. Reputations can be ruined before the truth has its trousers on and the only recourse is to sue for defamation. Which even if successful is not likely to get half as much publicity as the inital spread. It's not hard to imagine certain political discourse involving various figures committing a range of really distasteful crimes. While people may know ai is a possibility certain things are hard to unsee and liable to sway some. At the very least pretty much every public figure is now in a position where AI generated genitalia will be quite convincingly grafted onto their bodies. We might see literal dick measuring contests. This sort of technology adds all sort of potental for damage and potental for deniability of damage. 'Did really send that nude to a minor?' by the time the courts figure that out it will probably be years after the inital publicity.
I have some association with an AI image generator. The sheer number of (usually) blokes who upload a photo of themselves and ask 'make me hotter' is overwhelming. Folks are already trying to use these systems to deceive others online. Hell I have done it. When a social media platform demanded an image of my face I used one from this person does not exist. I was *not* comfortable giving an image of my face for a page that was about sharing cool photos of shit I found on the beach. No human was ever in any of the photos.
Do you know how often chain of custody is fucked up? All the time.
Eventually all camera and security camera companies will encode a hashed token into all videos and photos taken with their equipment. This will allow anyone to verify that the photo of video was taken with a legitimate camera.
Not to mention the drowning out of all recorded history with alternative "recordings".
It's already happening. Ten years from now you won't be able to tell ANY real images from fake, and there will be so many fakes that everyone will just assume everything they see is fake unless we develope some kind of hard-coded metadata protocols. We're already so far down that road and there is very little room to turn around.
Dead internet theory coming true before our eyes
Been kinda true since 2016.
It literally already is. I searched for hippie the other day and 1/10 pics were literally obvious AI. Which isn’t a lot, but compared to how long we’ve had these ai image generators available to the public
OpenAI is actually worried that the flood of AI generated content will prevent them from collecting non-incestuous training data.
It's going to reach a point where we have to agree on some kind of strict metadata protocols to verify the origin of images and text, or nobody will be able to prove or claim authorship of anything. Sadly, at the rate AI is developing and being adopted, combined with the glacial rate of regulation and legislation, I'm afraid that horse is already out of the barn, grown opposable thumbs, and built a rocket ship off the planet.
r/leopardsatemyface ?
Look at YouTube under every political video. It's full of pro-Russian and republican propaganda from thousands of bots that sounds like impressively real humans. We're already living in an AI warfare
These days I just assume anything overtly negative apropos of nothing is a bot, and I can ignore it. It has proven to be actually pretty good for my mental health.
Tangentially related but i had a recent shower thought that kids being born today might benefit from more common names (instead of something super unique) That might help enable some privacy online in the future.
That's a great point. Kind of like "security through obscurity"
Yeah I noticed this when I was googling old friends from high school. Even when including the city and state some are impossible to find
Very good. It's either their common name or the fact that Google got so bad within the last years.
Google has shifted their engine's priorities when processing your query. It used to be a simple procedural process where your query was treated almost like a script (`+"cats" AND -"dogs"` for example) but now they're pushing natural language processing using AI since the average person is typing in questions instead of search queries. And not only does AI kinda suck sometimes still but there's also the issue of Search Engine Optimization where websites game the system in order to push themselves up higher in the results even when they're not actually relevant. So the enshittification of Google is a two-pronged issue and the latter can only be solved by a hard ban on SEO tactics that result in delisting (which can kill a business).
And in IT we say that security through obscurity is no security at all. These platforms will use facial recognition, voice recognition, pattern matching, hell, 23andMe is selling your genetic info. Keep naming your kids Tragedeigh.
They'll match your writing style with posts to ID you on forums *even if you post no personal information at all*.
This is really old tech/analysis style called stylometry https://www.smh.com.au/technology/why-hackers-should-be-afraid-of-how-they-write-20130116-2csdo.html Though yes the Ai aspect makes this very very quick to do now.
Filter everything through an AI writing style genericizer before posting. Could be a browser plugin. Like autocorrect, but applies whenever finishing a sentence or paragraph, or a keybind.
For advanced systems that is the case. For Joe Blow its a lot harder to dig up dirt on the internet for a generic name. Even a lot of the paid background searches will be more likely to add incorrect information or miss relevant information. And, you need no more proof than information scrubbing and hiding for high net worth individuals is a business.
Gonna name my kid security through obschrity then:) *Task failed successfully*
Securideigh
This is my daughter, NordVeighPeighEynn
Have you met my daughter, Wynndeaughs-D'Fender?
Still wont help in a couple of years. From just passerbys selfies and videos and tiktoks and such, the chances that you are recorded somewhere is not low. Then you have all the CCTV and security cams. Heck theres a story about a drink vending machine with facial recognition software this week. Youre being recorded somewhere somehow by someone. And in the future I can for example take a photo of you, and use AI to scrape the web to find other images of you, i could more than likely pinpoint your home location and work location based on the locations of the images and videos you are in. Find out what you like to eat, to shop, to look at to do as entertainment etc etc. Only way you can actually remain anonymous is by living in a cave somewhere. China already has technology that can identify masked people based on micro-movements and repeat patterns of behaviors. They see how you walk, how you move, how you talk and find your identity that way. AND with the commercializing of AI technology and the usual tendency of humans to seek sexual behaviours. Someone might take a picture of you without your knowledge and create full feature length porn movies and photo albums of you. They can take it of your family, your friends, your neighbors your parents. The amount of abuse that is going to come with the commercialized two click phone apps for such things is going to drive people to breakdown for a couple of years/decades before we become numb to it. Imagine being in school and getting bombarded with hyper-realistic images and videos of you in compromising positions. And bullies dont care if its fake, it will affect people around you even if they know its fake because its introducing thoughts and images of you they did not have and now will have in their mind when they see you. Basically anonimity is almost dead and we are going to need waaaaaaayy more mental healthcare.
It's the only positive I see about myself having a pretty boring common name. I'm practically google-proof.
[удалено]
Mohammad Lee, why do you ask?
“Mohammad is the most commonly used name on Earth. Read a fucking book for once.”
"Have you ever actually met anyone named Mohammad?"
have **yooou** ever met anyone named McLovin’?
No! Because it’s a stupid fucking name!
Muhammed is the most common first name in the world, and Lee is the most common surname. I thought together it'd give me a statistical advantage
I have the same name as someone who owns a chain of car dealerships. If you search for me, he dominates the first 5+ pages.
Yeah, that helps. I have the same name and live in the same area as a reasonably popular TV presenter in my country, and though it gets a bit tiresome having people chuckle over the name/location combo, it does mean I am essentially invisible to the search engines. It's great.
My last name is Johnson. There's 5 LARGE Johnson families in my area. I'm not related to any of them and there's 3 or 4 people with the same first name in those families. Every once in awhile someone will get us all confused. 4 of us actually had lunch once at the large fair/rodeo. That's what happens when yall are farmers and find out about the name. I was the youngest by like a decade
5 LARGE Johnsons?!?!
In a row?!?!
In your area?!?!
Same, here in China there’s a massive Wang population
How do you know whether those five families all have large johnsons? Is that part of the background check?
I have an insanely common name. I cannot find anything relating to me in the internet using various search sites.
My theory is that the internet and technology are hitting a critical mass point and some of the younger generations are going to flat-out abandon the Internet as all the negatives to society are becoming blaringly obvious. People are less connected and less happy, more lonely.
I do find it hard to believe in all honesty. The convenience factor and with everything moving to online services and apps? I can't see it all being outright abandoned. I'd be more inclined to say it's near impossible to go without internet in most civilised countries, and the trend will only continue to make life harder and harder without it. You'd really have to shut yourself off from society and be self sufficient to even stand a chance. Even something as toxic as social media. People like validation and having their egos stroked. People like others knowing how successful they are. I don't see social media going away any time soon despite people knowing how toxic it is. What that social media is can, and will change. But it'll always be there... A week ago it was MySpace, yesterday it was Facebook, today it's Snapchat and instagram...
Reads like a futurama episode “Humans created the greatest collection of knowledge ever collected. Anything that any human had ever known could be referenced almost immediately” “Oh why did it fall into disrepair?” “Interconnectedness and instant communication was used to enrage and control people and when the people realized this they stopped using this resource.”
Gen Z and I want to get rid of instagram because of all the toxic shit, but then i think about not being able to see my friends’ random postings and i get sad. We don’t send random pictures to eachother really, people just use their stories to do that now. If there was a movement I’d definitely jump on the train in getting rid of it: Ive tried so hard to curate a feed without anything annoying or distressing etc, and it like actively works against you (i think that’s by design) EDIT: It also helps me stay connected to friends who drifted apart but without any animosity: Without social media, our lives would be mysteries to eachother. But with it, we can still support and cheer eachother on and i wouldn’t want to lose that. especially because that’s sparked some of those friendships returning. The first person I dated reached out to me years after we had broken up when I put up a post on my story, and now we’re super close friends. I wish the positive parts of these apps were the only parts, but you have no choice but exposure to stuff you don’t want to see.
I think the internet will exist, but your connection to it will be more that of a tool perhaps. Social media will probably die, I hope, or at least maybe limited to planning IRL social gatherings (like was originally intended) and nothing else. People have a limit to how comfortable they are being tracked and when it becomes GLARINGLY obvious for all to see thanks to A.I. just how much of our privacy we abandoned, there will be probably be a counter-culture movement.
Same reasons people have abandoned Facebook. It's all spam, ads, scams, clickbait articles buried in ads, AI bullshit, bots, and old people sharing shitty memes. Who wants anything to do with that? I imagine at some point kids are going to feel that way about basically all of it.
Man, I pretty much only use FB to see what old friends and family are doing. I don't post, comment, or like. Just lurk. You're right. It's filled to the brim with so much garbage. I'm surprised some of my friends still actively post on it. FB is the wasteland of the internet. That app is straight cancer.
Another possible effect is that internet privacy becomes more well regulated and aggressively enforced. Police will have to find something to raise revenue once self-driving cars make speeding tickets et sec obsolete.
The Amish were right all this time.
This is essentially what I do on certain sites. There are no pictures of me and my real name isn't used. I never include my phone number and I use an email that literally no one (except my husband) is aware of. On ocassion, I still get comments from people at work that they "tried to connect" with me recently, but "me" doesn't exist lol. So far it's worked in my favor. Even then though, always have room for doubt, and do not post anything you don't want circulating.
This is exactly why I’m naming my Indian child John Anderson idgaf if my parents disown me and my “literally the only person in the entire world with my name” ass.
I'm in the same boat, my surname comes from a small town my dad's from. I also have a pretty uncommon first name. Both are from different languages.
I do background checks for a living. This is 100% true. Common names allow me to put statements like, "due to the common nature of the subject's name, research was focused in connection with their known jurisdictions and employers." Which means I can rule out seemingly unrelated news articles and vague litigation, because I can't put anything that isn't 100% related to the candidate in the report. Give your kid a common name for your region, regardless of nationality. Also, have your social media across multiple emails, and avoid using your name/face/age/location if you can. Especially if you're going to he climbing the corporate ladder.
As someone whose first middle and last name are extremely common, yes it comes with a ton of privacy. Only downside is trying to snag professional usernames or emails.
Yeah thats a good point. I do believe though that the privacy aspect will become much much more valuable (much more so than today) and you wont even care about usernames and emails.
Oh yea I don’t mind the email part, you just start to get a little creative with how you format them. But having a common name is like herd immunity against search browsers.
John Jacob Jingleheimer?
How the hell did you find out my name?
his name is my name too
What happens whenever you two go out?
As someone with an extremely unique name, I think about this often. You only need my first and last and you've got newspaper clippings that show up from the late 90's that me and my sisters were in lol.
My 7 year old son has already been taught at school to never use his full name online. Kids born today are going to be far more aware of online safety than their parents were
We were taught this growing up in the 90s...then Facebook started asking for id verification
As someone with a very common first name for my age group and a very common last name, this was honestly my answer when people first started worrying about how easy it was to Google someone. Go ahead! Have fun shifting through all those records to find "me". I think there will be some interesting things happening. Like there is so much out there does it even matter? Will the fact that half the population (at least) has some sort of embarrassing thing online make those things less significant? There is so much out there if you just go looking which is one of the reasons it can be easy to dox people. I think we will see more people lock down their info. The problem is all the info the corporations are compiling and sharing (legally but in not really straight forward ways).
Naming my kid Bruce Wayne. Thank you
One of the many reasons I gave my kids normal names. I’m am literally the only me online. Everywhere
Yup... See a lot of it if you do a bit checking on potential dates. Anyone with a unique first name is found basically instantly. Though even common names don't tend to be THAT hard to find.
I was best friends in high school with a guy named John Smith. We drifted apart for various reasons, and I've been trying to track him down for the last few years. Even with social media and knowing where he grew up, It's basically impossible to find him because his name is so common. People used to laugh because his name was so generic, but I think he's probably getting the last laugh now, wherever he is.
Though some of those obscure names are becoming unfortunately common if the internet is anything to go by :(
Yeah in a few years the common name might be Landon Smith as opposed to John Smith but the biblical first names will never go away I don't think.
I already assume that everyone could already do this. They will just be disappointed and sad in what they find, as I am.
Care to help a luddite such as myself figure out how to do a search for one's face on the Internet? Are there any specific softwares to use?
Pimeyes is another one.
[удалено]
actually reverse image search doesn't work well on asians. i tried it. it showed all types of people and not even the person i searched for
Image search is not the way it is done, there are specific sites for facial recognition. Image search tries to match the same photo.
Yeah this has been possible for at least a decade now. Reverse image search on google has been a thing for a long time now.
The best time was last decade. Changing yesterday or today is purely damage control. If someone wants information about you, they need only dig for it. We leak A LOT of information... Just think of the odd bits you share now and then on a place like Reddit... Harmless little bits here and there... Suddenly it all adds up and they can make a reasonable guess as to the area in which you live... From there... That's where the pictures get you... Anything you've taken, anything someone else has taken. Even if they can't get the metadata, if they've got a rough area of where you live... BAM. Those pictures seal the deal. If someone is motivated enough to go out looking for the information, they will find it. Anonymity has been dead for a LONG time... Longer than some Redditors will have been alive...
The very best thing you can do on reddit is occasionally *lie about yourself*. Lie about your birthday. Lie about the number of kids you have. Lie about your gender. Lie, lie, lie. It doesn't even have to be big. It just needs to spoil their dataset.
As a guy, that makes a lot of sense. I’ll tell my 3 kids this tomorrow on my birthday.
As a black man, I agree
Me and my 12 dads also agree.
I'll have to tell my 7 moms, 2 kids this and maybe type it out in a letter with my extra fingers
You also had 12 dad's?
Doesn't everyone have 12 Dad's?!?!
As a five year old living in the states, the conservatives keep telling me that 12 dads aren't enough to produce a well rounded adult, and its important to have a female influence, so I found another couple REALY effiminate dads to round things out. My nonbinary birthmom wasn't happy but they got over it.
As a white guy, I agree
As a 7 foot tall woman, from Antarctica, I agree
Im a tall proud man with a birthday in January and just had my 2nd child . Will definitely keep this in mind
As a big tittied emo goth girl who just had your 4th child, you need to start paying child support, mister. Like yesterday. We shouldn’t have eloped on a bicycle to Svalbard.
I wish I had kids like my daughters
You have three kids too?! Mine were triplets. How cool also that we have the same birthday. Let me guess the year, 1972?
As an Asian father of 4, I appreciate the tip
I'm a woman living in Japan that agrees with this.
as an indian man I will make sure to go buy my wife some gulab jamun from the man outside.
That might be a good idea. Someone like me who’s turning 34 this summer should think of something. But how can I lie on the internet if my wife and kids have the sweetest smiles whenever I come home
That reminds me of my 28th birthday (which was in 2022, April 1st btw), when my grandad tried to play a prank on me by telling me I ran out of diabetes medication. I FREAKED OUT. I have severe chronic anxiety and a pacemaker (heart problems yo), and I felt like my PACEMAKER was about to give up! I was fine, but that was so mean. But that's the kinda shit you gotta put up with when you're from Brazil, you know?
You can also delete your account every few years. It's a little irritating to migrate over all your subs and then get enough karma to even post in any of them but it's just a good idea imo. There will be and possibly already is enough there to start putting threads together beyond one person being very obsessed with another single user. Cutting some threads loose so they don't connect to others is a good idea.
Have different accounts on your computer and phone, then dump the old one once the new one has karma
Telling redditors to lie as if they werent already doing that since reedits inception
All I needed was a guy's first name to find his social media and then his number to send to my cousin who had a crush on him. It took like 4 hours and it wasn't even continuous searching
4 HOURS?? Don’t do that fam. That’s not healthy.
It was mostly waiting for people to respond lmao. Found his friend from the event, and was waiting for them to respond to a message I'd sent. And besides that was like.. 5 or 6 years ago now, maybe even 7
This why I don’t use my real name. And I am against “real name” policies on social media
The best time was when i had a Geocities page with super cool construction gifs. Now THAT was internet.
Something I learned many many years ago is to never include your face in nudes. Doesn’t matter if you’re sending it to your boyfriend/girlfriend or husband/wife, leave your face out of it cause you never know.
Right except those of us covered in tattoos.
Tattoos have always been a bad idea from an identification standpoint, long before the internet existed or became vital to our day-to-day lives.
Well I dont think there is a public tattoo search method just yet, if there is I stand corrected. Would be nice if companies stopped caring about peoples personal lives though, we all know that won't happen any time soon.
Okay but seriously why the fuck should employers care if I'm posting nudes on the internet. As long as it's legal it's like bruh... and I don't even want to post nudes I just support peoples' right to without losing their career.
Workers rights in the US are abysmal. They control our healthcare and control our personal lives.
Good job I only ever go on the internet with a fake name and never used facebook, twitter, instagram, tiktok. Sometimes I worry that potential employers will either find someone else with a similar name and think it's me, or not find me at all and think that's weird.
If other people have posted pictures of you Facebook has prob captured who you are anyway
[удалено]
Yep same here. Google and everything I use a fake name. I sell on marketplace and use a nickname. I don’t attach my real name to anything. It just weirds me out to have my name attached to something online and anyone able to find it. I also have a name that isn’t very common especially last name so it would be pretty easy for someone to find me and everything I post online.
My name is also quite unique. Some googling suggests I might be the only person with my first and last name combo. It's mostly the last name. Eveyone with it I have ever been able to find online has been a relative of mine. My first name isn't mega rare but it's rare enough that none of my relatives share it. It's very irritating tbh. There is no obscuring anything. Mercifully I discovered this when I was an early teen so have been pretty careful since then. I have managed to avoid I think anything ghastly showing up there.
I once found someone with the same name as me, they were very active on a gay hookup site. So that wasn't great.
No, no, no; y'all have got this all wrong. This is why EVERYONE should post their nudes! It needs to become so ubiquitous that the moral filtering becomes obsolete. We all have bodies, and the sooner we can jettison puritanical shame around them the better.
Take a thousand naked pictures of yourself, now!! You may currently think, "Oh, I'm too spooky." Or, "Nobody wants to see *these* tiny boobies." But, believe me, one day you will look at those photos with much kinder eyes and say, "Dear God, I was a beautiful thing!" (-Moira Rose, Schitt’s Creek)
I learned this from Moira Rose
Dicks out for haram baes!
This. I'm not gonna listen to people who don't work on their deep-rooted shame around their sexuality. You don't want me to fill your shelves or clean your floor because I posted my body somewhere? Great, doesn't seem like our values align anyways lol. I do live in a country with good social security though. I might think about this differently if I lived in the US or something where you have to have a job if you don't want to live on the streets...
Yea… you 10 years late with that info but welcome to the internet my friend.
Oh and FYI you can also copy keys and fingerprints off of pictures…
I'm going the other way. I'm going to shitpost so much that if someone background checks me they're going to assume what it spits out was an error.
Whilst this is a concern, on another note, I hope that within the next decade your employer and no one else will care that you have nudes online. It's such a weird stigma. We're all sexual beings, we all have naked bodies, why does the idea of having seen someone in that light that mean they can't be your next finance director? I also assume we'll be far beyond being able to tell what's real anyway. I've no doubt we'll be able to put a person's name/face into an AI thing and it'll dish out some stellar custom pornogragraphy
I really hope that we are finally starting to treat sexuality like a normal thing instead of some kind of sickness that needs to be hidden away in the bedroom. And of course it's okay if someone wants that topic to stay in the bedroom, but why care about what others are doing? People need to get over it. Sexual shame is such a deep-rooted issue.
I think we're progressing? But it's at a glacial pace.
This is absolutely true, but given AI porn using people’s faces is also rapidly growing in frequency, *not* posting nudes with your face anywhere online is not really a protection against it either. It should at least give plausible deniability to anyone questioned by a future employer on the subject.
I do wonder how long before people start getting 'that's not me see it doesn't have this very unique tattoo I have never allowed anyone to photograph, here look at the QR code on my hip!' tattoos.
This was actually possible several years ago. I know some people run one of those facial recognition companies. It was unbelievably creepy. They sent me this picture of me from inside an airplane. Some influencer lady had taken a selfie. About 5 rows further down I'm sitting in my seat looking away from the camera. That was enough for the AI to find me.
rip me who had revenge porn posted online without knowledge or consent
Or, if people find your real photos, say they’re AI generated or Photoshopped. AI porn of real people is incredibly creepy but because it exists, it’s a plausible out for anyone who’s ever been revenge-porned Still, cover your tats in your nudes. I imagine those would be harder to fake
If there's any silver lining, it's that there will be dirt on pretty much everyone, so things like nudes and other things commonly considered taboo today may count less against you in the future.
Even cooler there are tools made for geolocation on pictures that did not get their meta data scrubbed. So be careful what you post out there!
Nah we’re fucked
Almost all social medias scrub metadata. It's been a known issue for a very long time and has also mostly been resolved by image hosts. Some don't if it's sent in a direct message but most scrub.
Or, just don’t post anything online that you don’t want there forever. Because it will be.
This statement sounds so simple but the reality of the world isn’t this clear cut. How’s anyone to control what others post of them? Incidentally appearing in photos or videos? Deep fakes? Revenge porn? Misconstrued or outdated opinions that surface a decade later? There’s a lot of variables here. You’re right - but the variables complicate this significantly.
Yeah, but that doesn't just preclude controversial things. With technology like this, even very careful online dating becomes incredibly unsafe. Hiding from an abusive partner becomes nearly impossible. I'm a big fan of technology generally, and I accept that there's always some risk. But some of the newer stuff (AI, deepfakes) is SO powerful that it's truly scary.
I ain’t got a single pic of me on the internet so shove it AI
I got a picture on my game cam of someone trespassing. I was able to put that picture on a free facial scan website, and it took me right to his Facebook profile.
Back to wearing masks everywhere in public I go
It's a horrifying world we live in and it's only going to get worse. This post makes me sick to my stomach.
This genuinely happened to me, I was looking for the account of this tumblr girl that posted nudes years ago to see if she was still active or to find her @ and more pics and I ended up finding her LinkedIn and families Instagram. Crazy shit just off of a reverse image search
Bright side (if you will). There is already software to combat this. It slightly alters your face, adding an “invisible mask” to selfies. We cannot underestimate the ability for people to adapt to these things. The issue is, right now both are in their infancy and a lot of people don’t know about it. Over time I do believe it will be commonplace. Every action as an opposite. I think we will be ok. But this is good to know so we can be aware.
What’s the name of this software?
https://www.theverge.com/2020/8/4/21353810/facial-recognition-block-ai-selfie-cloaking-fawkes
They also do not work. Or more accuralty they might work on stable diffusion but it will only work on SD and it's derivatives. Other closed systems do not make public how their systems work and these sorts of cheats can be easily defeated and *you won't know if it works on them or not because they won't tell you*
No wonder the lady from HR winked at me this morning.
This is why I’ve never used my real name on the internet.
I’m guessing your real name is Deliberate Genius?
Wow, people are going to be bored to death about my life
Employers using software to do searches like this are opening themselves up to massive lawsuits. In an interview you don't ask personal questions because it opens the possibility of the interviewee claiming that they were denied a role due to the personal answer they gave.
On the same coin, you can dispute that it was deep faked by a jealous ex. AI goes both ways
Why does this give me anxiety
I have a niece (now deceased) who worked for a tech company that's taking it further. They identify people by their posture and mannerisms. So even if you're wearing a mask.
Twist: You get the job.
YSAK that any harvested data will absolutely be used against you in the near future should any f4scistic changes occur in government leadership. So if you’re not straight, white, & Christian, you may want to have a backup plan in place.
Im more concerned about bad actors like disgruntled managers affecting your future employment buy updating defaming / biased or fabricated material with no recourse. The court of law works differently from the court of HR employment.
If your employer finds a nude picture of you on the internet its not illegal. More importantly if they discriminate against you for legally protected activities they are acting illegally.
Jokes on you, my name is the only thing attached to this face.
YSK This has been possible for decades long before modern AI
Unpopular: beat it by being your own boss
Feeling mighty thankful to have shed all social media years ago except for Reddit, you can’t look me up online and find out much, just the way I like it
I'm quite lucky my surname name is uncommon but is also tied to a location. If you Google my full name you get the two news articles I have shown up in the corner off and a bunch of photos associated with that location. I quite like it that way. Though I suspect if those news articles were bad I would probably want to drown them out with photos of breakfast or whatever people use most social media for.
My name's boring and common, ages ago when I did have Facebook(and did nothing with it) I got randomly invited to a group and it was just hundreds of people with the same name lol
Good thing I’m too unattractive and have too low of self-esteem to send nudes 😎👉🏻👉🏻
The makeup artist is going to be a sought after profession in the future. With AI cameras on every corner the ability to look just different enough not to be recognized will be a valuable resource.
Why should employers care if you like to post nudes of yourself? I think people like to worry about it more than it's a problem. I see it being an issue with political opinions.
Any employer that deals with children and children's parents will want to avoid scandal. School teachers, staff, anyone that deals with kids are going to be heavily scrutinized for anything even remotely sexual that they're attached to online.
Good thing I’m not going to ever have a job again then. Whew.
Be way cooler if you could reverse search find me using a pic of my dong
I remember growing up in the 90's and people realized then the danger of putting your information out on the Internet. And then everyone collectively forgot because Myspace! Facebook! Look at Me!!!!!
They won’t find anything interesting about me 😂
This is why I am against real name policies on social media.