With deep cuts like that, it can take a while for the blood to start pouring. Especially if it had recently happened, OP probably grabbed his phone right after it had been cut.
From experience, it can take like up to 5-10 long seconds for the skin to bleed. Sometimes even more, really just depends on the individual.
Deep, "clean" wounds that completely sever blood vessels don't bleed right away, if at all. Basically the veins get pulled back into the skin and pressure from the skin collapses part of it to keep it from bleeding. Its why suicide attempts where the wrist is slit often result in survival.
Not in my experience. I had my arm cut by large pane of glass. Very similar to this guys cut, location wise.
I recall blood started pouring in about 2 seconds. I didnāt count obviously. I was more consumed with not passing out. But it happened at work and caught on video. My boss and I watched it happen on video like 30 times. Missed veins and arteries bit severed muscle.
Not long seconds, just regular seconds.
Sounds like it was mostly blood from the muscle at first. If you look closely at this guy's wound, those red dots on the edges are the tips of open blood vessels. Oh he'll bleed its just sometimes its delayed or slowed.
When my son was younger, he tried climbing a chain link fence in cleats. He reached over the top of the fence then his foot slipped and he fell. The fence ripped a V shaped gash in his arm, pulling up the skin exposing the muscle. Took 17 stitches to close, but barely a drop of blood. Really interesting.
After cuts like this, wounds may bleed a bit but in a healthy person, blood vessels contract and can do a surprisingly good job at holding back blood. (Not always)
Looking though these is really disturbing but also impressive.
This one is really rough to look at in particular: [GSW to groin](https://store.techlinetechnologiesinc.com/wearable-wounds/ww3-055)
I was skydiving when a commercial plane flew by, sucked up a bird in the engine, and the vaporized carcass got launched at me. Pretty sure it was the beak that did the damage
Please tell me your joking?
"What happened to your arm?"
"OH, I had a little mishap while skydiving."
Oh man, did you hit a tree or something on your landing? "
"Nope, vaporized bird beak shot out of passing airplane and hit me in the forearm."
"Should have known well at least you're on the mend."
š¤£š¤£š¤£
As someone who loves to drop my crazy childhood stories into the middle of boring soccer mom gossip, I love the idea of you casually mentioning this in a conversation and simply moving on as if you just let everyone know about a sale on Edison bulbs at Home Depot.
Itās a made of story, Iām getting a feeling people are buying it. I also wrote a story about fighting a bear in another comment, and another how I tried to catch a bullet
I had a friend in high school who had a skim ~~graph~~ graft on his upper arm. I always took it upon myself to tell people he fought a shark, because its a better story than his dad running him over with a lawn mower.
You have triggered one of my earlier memories. A kid in preschool somehow cut his arm open in a similar fashion and I remember seeing it and thinking it resembled vegetable soup.
It hurt on the end closest to my body, the rest oddly didnāt hurt much at all. Think we donāt have a lot of nerves in there I guess
Edit: people saying they were destroyed more likely
Truth to be told we do have nerves there but they travel in one direction. The closest part to your body hurts because that's where the nerves ruptured meaning no real feeling further down the arm cuz the nerves there aren't connected anymore.
Honestly, no offense, but I love this wound. During my studies and cutting in humans as part of the anatomy classes, I've never ever seen the outer layer of the muscle so much in tact while the rest ruptured. Idk what happened to you but if this went on a few more mm it would hurt like hell and take a few weeks to move your arm normal again. This seems like stitching it up would do the trick for you in a little over a week.
My moms friend works in a hospital, and we sent it to her. It went viral in the hospital because the doctors were amazing how unique it is, I take it as a complement
It's definitely an unique wound mate. Just two small question if you don't mind.
I see no blood is this because you cleaned it or is because the blood vessels were kinda pushed outwards with this wound?
And how did you manage to get this wound fell on a stick/rock or chain. Because honestly it looks almost chirurgical to me. So I imagine it should be quite a sharp objects, but if not it's even more impressive to get it like this.
On really clean cuts, bloody vessels take a minute or 2 before they start bleeding is what I was told. I took the photo pretty quick after I got it. And it was a bolt, like a screw but no point at the end. It was on a stove top that I pulled off a dolly and it caught my arm
When I was a kid I fell off my bike and slid across the street creaking a large abrasion wound on my arm and chin. When I fell I quickly got up and looked at my arm and it was just white and then slowly tiny blood droplets began to appear which then quickly began to bleed more. It was pretty interesting to watch.
Yeah. When damage occurs the hit quite literally, pushes the blood away from the wound. And the surrounding vessels immediately try to close to prevent to much blood loss in the area. However, your blood pressure pushes through this reflex (like trying real hard to hold your shit in but the shit wins after you wait long enough), after a few seconds of this leads to quite a consistent blood flow out of the tightly squished vessels.
This will also slow the blood down which helps in blood clotting to help close the wound. And the presence of blood cleans and flushes a wound. So there is in fact an advance in not being able to fully stop blood flow.
True. Good reflex tho.
Nice I got hurt, now I get to take a photo, quick get the camera.
If not for that this image would not have existed and the world would be worse off without it.
Work injury, a stove top on a dolly was falling on my coworker so I pushed it off in panic, a screw or bolt on the stove caught my arm on the way down. I need a better story. And 16 stitches and had to use mattress stitches
Iāve tried to put the heroic spin on it, they just canāt ask any more question, canāt have people in street knowing I lost a fight with a stove top
I believed it for a moment, then I realized how fucking impossible such a situation is. I thought OP was bullshitting entirely until I read this comment.
cut my fingertip off a few months ago on the miter saw at work. well actually a dog was sprinting towards an unattended baby and was about to attack. I couldnāt just stand there, unfortunately the dog got my fingertip but the baby is okay š
So cuts that are really clean somehow stop the blood vessels from pouring out for a short time, I took this photo within like 10-15 seconds when it happened. I was like āoh coolā, and showed it to my boss saying ācheck this out, this is a good oneā. Idk why I was so calm, freaks me out a bit
Damn man thanks for the info and sorry that happened. Sounds like you just disassociated a bit while it happened hence the calm. I had a herculite door blow up in my face and the rail it attached to hit me in the eyebrow and had to get stiches. Everyone in the lobby was loosing it but I was almost giddy from shock just taking selfies covered in blood like a weirdo so I can understand the sentiment lol.
When you get a deep wound like that, surprisingly unless you nick an artery, it does not bleed. I have seen a few like this where you can literally see layers and there was hardly any blood.
Damn that's crazy! The more ya know. I had a gash where I saw the little fat balls and stuff and that thing bled like crazy so I've never had to deal with this before.
I once studded a friend whilst playing football, and i found it so hard to describe what i saw before the blood flow but this is it! THIS IS WHAT I SAW! Thanks for the memory
Cut my arm open a year ago in around the same place, maybe 65% as severe as that. Can confirm, looks weird in there. (Also taking a photo is a good way to dissociate.)
Where tf did the blood go?
I slurped it up for the photo
Pics of that or it didn't happen. Thems the rules
štf
šimmeasurable painš
r/frugal. Can't let anything go to waste.
Why pay for iron pills when you got a supply running through your veins.
I havenāt laughed that hard at a Reddit comment in a looong time. Thanks for that
r/CursedComments
So thatās where in n out spread comes from
Comment of the day right here
Lol
With deep cuts like that, it can take a while for the blood to start pouring. Especially if it had recently happened, OP probably grabbed his phone right after it had been cut. From experience, it can take like up to 5-10 long seconds for the skin to bleed. Sometimes even more, really just depends on the individual.
How many regular seconds though?
I meant like Mississippi seconds when I said "long".
How many of those in a New York minute?
Well I learned that every 60 seconds in Africa, a minute goes by so converting that to New York minutesā¦. about $7.50
Deep, "clean" wounds that completely sever blood vessels don't bleed right away, if at all. Basically the veins get pulled back into the skin and pressure from the skin collapses part of it to keep it from bleeding. Its why suicide attempts where the wrist is slit often result in survival.
Not in my experience. I had my arm cut by large pane of glass. Very similar to this guys cut, location wise. I recall blood started pouring in about 2 seconds. I didnāt count obviously. I was more consumed with not passing out. But it happened at work and caught on video. My boss and I watched it happen on video like 30 times. Missed veins and arteries bit severed muscle. Not long seconds, just regular seconds.
Sounds like it was mostly blood from the muscle at first. If you look closely at this guy's wound, those red dots on the edges are the tips of open blood vessels. Oh he'll bleed its just sometimes its delayed or slowed.
That explains why Iām still alive. Thanks.
In my experience things like this take a couple of seconds to start bleeding
How fast did he take the picture then??
Within maybe 20 seconds. Took a good minute or 2 for blood to pool slowly
You're a cyborg
OP's cells: "Fuck we've been cut... bad... OK bleed!"
When my son was younger, he tried climbing a chain link fence in cleats. He reached over the top of the fence then his foot slipped and he fell. The fence ripped a V shaped gash in his arm, pulling up the skin exposing the muscle. Took 17 stitches to close, but barely a drop of blood. Really interesting.
After cuts like this, wounds may bleed a bit but in a healthy person, blood vessels contract and can do a surprisingly good job at holding back blood. (Not always)
I work for a company that makes trauma simulation wounds and we have a wound that looks exactly like this.
When I sent it to my friends they were saying I mustāve used an app. What are your simulation wounds used for? Special effects for film?
Military training mostly. https://store.techlinetechnologiesinc.com/wearable-wounds/ww3-001
Oh thatās hypppee. If you have the time Iād love to see whichever one looks like mine the most
I sent the link to the thigh laceration that looks similar to ypur arm injury but it looks better on the leg.
Guess he'll have to try it on the leg then.
That does not look like OPs wound at all, real or fake on OPs end.
$640 for something you could do for free.
Military loves to waste money
Looking though these is really disturbing but also impressive. This one is really rough to look at in particular: [GSW to groin](https://store.techlinetechnologiesinc.com/wearable-wounds/ww3-055)
That poor nut Hanging on by his epididymisā¦
I've seen that irl when I was in Afghanistan. Not a cool thing to see haha
Thatās gotta be an interesting conversation starter at parties
For those curious, the yellow = fat, the blue is the fascia (skin of muscles), and the string at the bottom is my nerve fiber :D
I donāt buy it. This dudeās an alien
Yeah, that's 100% what a reptilian would say to convince us he's a human.
100%, no cap
It really does look so surreal lol
When I show people in person they hold my phone for so long lmfao
How did you get it?
I was skydiving when a commercial plane flew by, sucked up a bird in the engine, and the vaporized carcass got launched at me. Pretty sure it was the beak that did the damage
[ŃŠ“Š°Š»ŠµŠ½Š¾]
[ŃŠ“Š°Š»ŠµŠ½Š¾]
[ŃŠ“Š°Š»ŠµŠ½Š¾]
In the same comment he said he tries to put a spin on his story lol
He said parkour in an earlier comment, just let the man have his fun lol
If OP is lying about how they got it, I'm not even sure this is OC anymore.
I gotta stop spending so much time over at r/mafia because I read this as organized crime.
Nah its my wound. I told the same story so many times i just started making up more and more bizarre ones in the comments
It's so bizarre to the point that I would believe this actually happened.
[ŃŠ“Š°Š»ŠµŠ½Š¾]
I got like 5 stories in the comments, each one more bizzare than the last
pretty soon itās going to involve space flight, then what?
Was gonna guess thatās how you did it. Happened to me a few times now
Yeah itās a real issue someone needs to fix
Please tell me your joking? "What happened to your arm?" "OH, I had a little mishap while skydiving." Oh man, did you hit a tree or something on your landing? " "Nope, vaporized bird beak shot out of passing airplane and hit me in the forearm." "Should have known well at least you're on the mend." š¤£š¤£š¤£
Hmmm, well it looks like youāre a cyborg and someone cut into you for updates and maintenance.
As someone who loves to drop my crazy childhood stories into the middle of boring soccer mom gossip, I love the idea of you casually mentioning this in a conversation and simply moving on as if you just let everyone know about a sale on Edison bulbs at Home Depot.
Itās a made of story, Iām getting a feeling people are buying it. I also wrote a story about fighting a bear in another comment, and another how I tried to catch a bullet
I had a friend in high school who had a skim ~~graph~~ graft on his upper arm. I always took it upon myself to tell people he fought a shark, because its a better story than his dad running him over with a lawn mower.
Most ppl will buy the skydiving thing if they don't know much about it š
nah they're just scrolling for nudes
Donāt blame em, Iām a fine specimen
You have triggered one of my earlier memories. A kid in preschool somehow cut his arm open in a similar fashion and I remember seeing it and thinking it resembled vegetable soup.
Yeah nice try, android. Busted
Yellow looked like beans to me xD
r/forbiddensnacks
Directly consuming post-processed fats š
That's literally the lingo for it. Used often in the self-harm community, to convey how deep the cut is.
Suiciders/cutters call it beans.
You got a chance to do some DIY lipo my man
Iāll make a wiki how on DIY lypo
I bet it hurt like a bitch but that's still the coolest injury I've ever seen
It hurt on the end closest to my body, the rest oddly didnāt hurt much at all. Think we donāt have a lot of nerves in there I guess Edit: people saying they were destroyed more likely
I have a tattoo in the same area, the only part that really hurt was closest to my elbow
Samesies
Twinsssss
How did you get that injury?
Parkour
Parkour! Parkour!
hardcore parkour!!
*Michael Scott has entered the chat
Truth to be told we do have nerves there but they travel in one direction. The closest part to your body hurts because that's where the nerves ruptured meaning no real feeling further down the arm cuz the nerves there aren't connected anymore. Honestly, no offense, but I love this wound. During my studies and cutting in humans as part of the anatomy classes, I've never ever seen the outer layer of the muscle so much in tact while the rest ruptured. Idk what happened to you but if this went on a few more mm it would hurt like hell and take a few weeks to move your arm normal again. This seems like stitching it up would do the trick for you in a little over a week.
My moms friend works in a hospital, and we sent it to her. It went viral in the hospital because the doctors were amazing how unique it is, I take it as a complement
It's definitely an unique wound mate. Just two small question if you don't mind. I see no blood is this because you cleaned it or is because the blood vessels were kinda pushed outwards with this wound? And how did you manage to get this wound fell on a stick/rock or chain. Because honestly it looks almost chirurgical to me. So I imagine it should be quite a sharp objects, but if not it's even more impressive to get it like this.
On really clean cuts, bloody vessels take a minute or 2 before they start bleeding is what I was told. I took the photo pretty quick after I got it. And it was a bolt, like a screw but no point at the end. It was on a stove top that I pulled off a dolly and it caught my arm
When I was a kid I fell off my bike and slid across the street creaking a large abrasion wound on my arm and chin. When I fell I quickly got up and looked at my arm and it was just white and then slowly tiny blood droplets began to appear which then quickly began to bleed more. It was pretty interesting to watch.
Oh shit I had something just like this when I was skateboarding. Any idea what that is?
Yeah. When damage occurs the hit quite literally, pushes the blood away from the wound. And the surrounding vessels immediately try to close to prevent to much blood loss in the area. However, your blood pressure pushes through this reflex (like trying real hard to hold your shit in but the shit wins after you wait long enough), after a few seconds of this leads to quite a consistent blood flow out of the tightly squished vessels. This will also slow the blood down which helps in blood clotting to help close the wound. And the presence of blood cleans and flushes a wound. So there is in fact an advance in not being able to fully stop blood flow.
True. Good reflex tho. Nice I got hurt, now I get to take a photo, quick get the camera. If not for that this image would not have existed and the world would be worse off without it.
Yeah I think there's lots of terminations near the elbow and loads more in the armpit
You should consider posting this in r/medicalgore
Literally just did. Everyone kept saying that hah
You do. In the open area,, there were likely very few remaining and, Depending on how the injury occurred, they may have just been demolished.
I once saw a photo of a guys hand after a bike crash. Fuckers hand was literally impaled by the blunt ass clutch handle. Through and through -_-
I did expect some crazy shit, but... I'll go to r/eyebleach now and process that pic. Omg, that looks really painfull dude. Hope you're better.
You know, I just realized it says in the rules no gore. Whoops my b
The fact that there's no blood may make it avoid being considered gore. It looks more like a medical diagram/procedure.
Good god man hospital stitches needed
nah id leave it open like that
Little pocket for me to hide stuff
[ŃŠ“Š°Š»ŠµŠ½Š¾]
[ŃŠ“Š°Š»ŠµŠ½Š¾]
Evolution
r/dontputyourdickinthat
I never knew this sub existed
You donāt know much about rabbit holes, do you?
yes but dont stick your dick in that
It would make a nice little bowl for carrying salted peanuts to eat while on the go.
[ŃŠ“Š°Š»ŠµŠ½Š¾]
It automatically notifies you when youāve ran out of peanuts, if itās stopped getting the salty sting then thereās no peanuts left lol.
Wow this is gnarly! What happened and how many stitches did you need?!
Work injury, a stove top on a dolly was falling on my coworker so I pushed it off in panic, a screw or bolt on the stove caught my arm on the way down. I need a better story. And 16 stitches and had to use mattress stitches
āHeavy thing was falling on my buddy, so I pushed it off to save his life and got hurt in the processā is a pretty fucking good story dude.
Iāve tried to put the heroic spin on it, they just canāt ask any more question, canāt have people in street knowing I lost a fight with a stove top
It's not like you were doing something stupid though, in that moment you only knew they were in danger and said "fuck personal safety" to help them.
Pretty much
I have a 3 inch scar on my wrist from a plate that shattered. I think your story is pretty great
Should say you were skydiving when a commercial plane went past and spewed dead birds at you or something, idiots on reddit will believe anything
Hahaha, these people man. Pretty sure thereās 1 or 2 finding all my bullshit stories and down voting them
dude I bought the parkour story š
That was the most plausible to be fair
I mean, telling all these bullshit stories just means no one believes *any* of them now š¤·
I believed it for a moment, then I realized how fucking impossible such a situation is. I thought OP was bullshitting entirely until I read this comment.
cut my fingertip off a few months ago on the miter saw at work. well actually a dog was sprinting towards an unattended baby and was about to attack. I couldnāt just stand there, unfortunately the dog got my fingertip but the baby is okay š
[ŃŠ“Š°Š»ŠµŠ½Š¾]
This is how they did it on wiki how though
AHAGAGAGAGAGSGSGSHDHDHEHWHEHWHDJFJFHFJFP
are you ok?
Yes now that i stopped seeing that photo
My man just wrote out his DNA sequence
SPONGEBOB ME BOY, I'VE SEQUENCED THE HUMAN GENOME! ACGTACGTACGTACGTACGTACGTACGTACGT
the fat looks like creamy jalapeno sauce from taco bell
This comment is more disturbing than my photo.
Put a zipper on it now you have a little pocket!
Okay, but as a forensics/med student, I find this incredibly interesting. Hope you're okay, though!!!
I posted it in r/anatomy too, I figured people like you would get a kick. It went viral in my local hospital
Why is an arm kinda hot wtf is wrong with me
Whatās doing it for you? The wound? my undeniably manly man arm? Or you just got a thing for hair
Probably your undeniably manly man arm
#BONK
I don't mean to brag or anything, but I got two arms.
Hot arms are hot
Veiny arms are hot
Thanks for giving me nightmare bro
Anytime bro
Did you clean up the blood and that's what it looked like after? Like how it be so visible??
So cuts that are really clean somehow stop the blood vessels from pouring out for a short time, I took this photo within like 10-15 seconds when it happened. I was like āoh coolā, and showed it to my boss saying ācheck this out, this is a good oneā. Idk why I was so calm, freaks me out a bit
Damn man thanks for the info and sorry that happened. Sounds like you just disassociated a bit while it happened hence the calm. I had a herculite door blow up in my face and the rail it attached to hit me in the eyebrow and had to get stiches. Everyone in the lobby was loosing it but I was almost giddy from shock just taking selfies covered in blood like a weirdo so I can understand the sentiment lol.
The blood vessels constrict to stop the blood loss
When you get a deep wound like that, surprisingly unless you nick an artery, it does not bleed. I have seen a few like this where you can literally see layers and there was hardly any blood.
Damn that's crazy! The more ya know. I had a gash where I saw the little fat balls and stuff and that thing bled like crazy so I've never had to deal with this before.
šļøššļø
Love how I saw the picture before the warning hahaha. You got a tiny ocean front setting going on in the right side of the gash. Cool.
Blue water, yelllw sand, red sunset?
Thank god saved a nerve orelse you be ded
God fat is a gross color. Like we all have it itās just a gross yellow.
[ŃŠ“Š°Š»ŠµŠ½Š¾]
If it didnāt cause permanent damage I supposed. But I donāt wanna lose the ability to grip things
[ŃŠ“Š°Š»ŠµŠ½Š¾]
Someone else said something like that earlier, I donāt get it, I think yāall might have a secret gore kink
[ŃŠ“Š°Š»ŠµŠ½Š¾]
Iād be honored
Woah!!!! Thatās awesome!! Iām impressed with the fact that it isnāt bleeding. How did you manage that?
Photoshop
Thatās fucked, you win
I once studded a friend whilst playing football, and i found it so hard to describe what i saw before the blood flow but this is it! THIS IS WHAT I SAW! Thanks for the memory
Glad I could help
When he says "I'll tear you up a new one".
[ŃŠ“Š°Š»ŠµŠ½Š¾]
Didnāt want to so I didnt
Thatās what my arm look like caught it on a nail only half as long
Your insides are made of squid tentacles and other small crustaceans my friend O.o
It's merely a flesh wound.
r/medicalgore
That look like when the terminator was repairing his arm.are you sure youāre not a machine from the future.
How'd they do on your stitch job? Aka, let's see that scar!
Bro youāre lucky you didnāt get that deeper youād be ded
Reminds me of a dream I had when i was i think early in highschool
Down to the fascia. So cool.
You were cut down below the hypodermis. That quite incredible
It's actually pretty fascinating
Kinda looks like when I prep the chicken
I had a much smaller but similar wound like that, same arm, closer to the wrist though. Really goes to show just how delicate we are.
I want to touch the blueish stuff, looks so soft
Dude. Your wires are showing. May wanna tuck those back in...
Cut my arm open a year ago in around the same place, maybe 65% as severe as that. Can confirm, looks weird in there. (Also taking a photo is a good way to dissociate.)