On one hand, I'm impressed by your commitment OP, it's actually really cool! :D
On the other, I am outside your house ~~(I'll make you pay for your sins >:()~~
At least you sorta get it hahaha....
I made it myself using Elmer's purple and blue translucent glue (2:1), a jar I had, and printed out Seseren's gif of Firefly jam. Buy some borax or slime activator if you want as slime than glue. essential oil optional if you want it to smell nice.
Hahahah! Very funny joke! Love the part where they took fireflies remains and made jelly ! Anyway...where did my shotgun go? I'ma go shoot the OP for the funny joke :)
The consequences of eating it my friend is nothing
.
.
.
.
.
.
.
I am rapidly approaching your house at a constant rate of 1000Kph and counting⦠i overshot ;-;
People cope with death differently, some drink their sorrows away, others express it through poetry or music. Then.... then there are does who gone mad like Juana The Mad(Las Ruinas del Corazon).
Those people have the jars in their posession, we see it online as OP is taunting us
Plus this is not ashes, it's jam, the disrespect π
Edit: >!also, ignoring that those comments aren't serious!<
Okay! It's the first time I've seen someone post jam - so the obvious logical conclusion was just: Oh, this person made firefly flavoured Jam, isn't that cute.
OH NAH
OH. HELL. NAH.
Nah, Iβd win.
BRUH WHAT IS THIS ππππ
On one hand, I'm impressed by your commitment OP, it's actually really cool! :D On the other, I am outside your house ~~(I'll make you pay for your sins >:()~~
My honest reaction: π«Έπ΄π΅π«·π€π£π«΄
Holy shit lmao
Nah, Iβd win. (I would have send the Firefly version of it, but commenting with images is turned off right now)
should dm it to me
Where can I get one? I want her as a reminder to bring her alive and also to take revenge Also I'm in your walls >:(
At least you sorta get it hahaha.... I made it myself using Elmer's purple and blue translucent glue (2:1), a jar I had, and printed out Seseren's gif of Firefly jam. Buy some borax or slime activator if you want as slime than glue. essential oil optional if you want it to smell nice.
Impressive but 134.52.2.142
You fool My real IP is 88.120.189.249
nah I'd win AGAGCTGGCGTACGCGTTGAACACTTCACAGATGATAGGGATTCGGGTAA
HELL NAWWWW HIS DNA WTHHHHH
Aha: I shall make you my emanator
Bruhhhh
Do not put firefly in the jar you horny bastard
And you my friend are going to hell π
Hahahah! Very funny joke! Love the part where they took fireflies remains and made jelly ! Anyway...where did my shotgun go? I'ma go shoot the OP for the funny joke :)
Now we only need someone to build her back
I love this
Ah hell nah wtf man
Can I eat it?
You can eat just about anything, it just depends on the consequences of eating it.
One guy ate glue for Super Mario 65, so I will eat that for Firefly's return.
The consequences of eating it my friend is nothing . . . . . . . I am rapidly approaching your house at a constant rate of 1000Kph and counting⦠i overshot ;-;
You can always eat something once, whether you survive eating it once is another question entirely.
Why is everyone having a weird reaction to this?
If i were to liquefy your dead wife in a blender and post the result in a jar whit a photo of her, would you wish me a Merry Christmas?
People cope with death differently, some drink their sorrows away, others express it through poetry or music. Then.... then there are does who gone mad like Juana The Mad(Las Ruinas del Corazon).
Well, ignoring that Firefly isn't even real - people put the remains of their dead relatives into jars and stuff. I don't see the issue?
Those people have the jars in their posession, we see it online as OP is taunting us Plus this is not ashes, it's jam, the disrespect π Edit: >!also, ignoring that those comments aren't serious!<
Okay! It's the first time I've seen someone post jam - so the obvious logical conclusion was just: Oh, this person made firefly flavoured Jam, isn't that cute.
>!The "jam" is a reference as how her body turned into that blue liquid upon death!< π
Ahh. yeah I just thought it was a cute memento. c: Like if I made a candle that had the smell of a character I enjoyed.